Codon optimality is driven in part through tRNA abundance, which is cell type specific in mammals and can alter translation and mRNA stability in a cell type specific manner (Goodarzi et al., 2016; Gingold et al., 2014). ESCs were grown in Knockout DMEM (Invitrogen) supplemented with 15% Fetal Bovine Serum, LIF and 2i (Peprotech PD0325901 and CHIR99021). The extent to which an mRNA is utilized is determined by its lifespan and rate of translation. The relative stabilities predicted by the two approaches were highly correlated. MicroRNAs (miRNAs) are small noncoding RNAs that extensively regulate gene expression in animals, plants, and protozoa. The loss of DGCR8 also resulted in an increase in the translation levels of ESCC miRNA targets independent of its effect on stability, consistent with miRNAs both inhibiting translation and destabilizing transcripts (Figure 4C). Be consistent! Nascent transcriptional changes between Ddx6 KO and Dgcr8 KO measured by 4sU-Seq are also well correlated (Figure 5—figure supplement 1A) showing that the correlation in mRNA changes is due to transcriptional changes, likely secondary to the direct effects of Ddx6 and Dgcr8 loss on the translation of transcriptional regulators. TREX selectively binds mRNA maturation marks and licenses mRNA for nuclear export by loading the export factor NXF1–NXT1. We apologize for this oversight. Simultaneous RNA-Seq and ribosome profiling experiments across a number of contexts show that miRNAs produce larger changes in mRNA levels than in translational efficiency, leading to the suggestion that mRNA destabilization is the dominant effect of miRNA repression (Eichhorn et al., 2014; Guo et al., 2010). Thus, the shifted reporter mRNA signals found during gradient sedimentation might represent partially degraded mRNAs, which dissociates with the translational machinery. DDX6 localized to discrete punctate in the wild-type cells consistent with P-body localization, as previously reported (Figure 3E) (Ernoult-Lange et al., 2012; Hubstenberger et al., 2017; Minshall et al., 2009; Presnyak and Coller, 2013). an activator exerting positive control. miRNAs function posttranscriptionally by usually base-pairing to the mRNA 3′-untranslated regions to repress protein synthesis by mechanisms that are not fully understood. Two UAP56/DDX39B RNA helicases are juxtaposed at each end of the tetramer, which would allow one bivalent ALYREF protein to bridge adjacent helicases and regulate the TREX–mRNA interaction. 2020 Oct;9(10):689-700. doi: 10.1302/2046-3758.910.BJR-2020-0140.R1. qPCR was then performed with the SensiFAST SYBR Hi-ROX kit (Bioline) on an ABI 7900HT 384-well PCR machine. A better discussion of the DDX6 role would make the paper more interesting to the wide readership. For KO versus wild-type analysis, a linear model was used for each condition in limma and significant changes in translation are based on the interaction term. MicroRNAs – targeting and target prediction Takay Saitoa, ... RISC then inhibits protein translation and causes mRNA degradation [7, 8]. This data, together with the lack of correlation for stability changes (Figure 5A), support the claim that the correlated mRNA changes are due to transcriptional effects and not due to changes in post-transcriptional regulation. How can an mRNA that is being destabilized have higher rates of translation? 2007 Oct 30;8:396. doi: 10.1186/1471-2164-8-396. Knockout of miR-21-5p alleviates cartilage matrix degradation by targeting Gdf5 in temporomandibular joint osteoarthritis. ... b. the action of RNA-protein complexes that inhibit translation by altering the three dimensional configuration of rRNA molecules. RNA is transcribed, but must be processed into a mature form before translation can begin. The p value was calculated using the Mann–Whitney test. MicroRNAs have emerged as important post-transcriptional regulators of lipid metabolism, ... By altering mRNA stability and/or repressing mRNA translation, microRNAs represent an additional layer above transcriptional control for both fine-tuning and dramatically altering cell ... and an increase in the rate of fatty acid β-oxidation . Surprisingly, the 4sU/total mRNA data showed very few changes in mRNA stability between the ESC and EpiLC states (Figure 1C and F). miRNAs can also inhibit translation initiation, specifically the function of the cap-binding initiation factor, eIF4E. One is that ribosomes sterically hinder the degradation machinery from accessing the transcript. To identify features that explain the range of mRNA stabilities observed, we performed multiple linear regression taking into account the following features that previous studies implicated in affecting mRNA stability: 3’ UTR length, 5’ UTR length, CDS length, 3’ UTR GC content, 5’ UTR GC content, CDS GC content, AU-rich elements (ARE), miRNA-binding sites, number of exons in the transcript, and upstream ORFs (Chan and Mugler, 2017; Cheng et al., 2017; Sharova et al., 2009). Unfortunately, tRNA abundance data does not exist for ESCs. Western blot confirmed the absence of DDX6 protein in both clones (Figure 3A). The lack of a change in the synaptoneursome/nuclear ratio of CAMK2α, GRIA2, and DLGAP2, 48 hours after SE suggests that the change in microRNAs synaptoneursome/nuclear ratio might be specific to microRNAs and not due to a global effect on RNA. Our data supports a model in which a single C-terminal tail tethers XLF to Ku, while allowing XLF to form interactions with XRCC4 that enable synaptic complex formation. Images taken at 20X. some stage after the translation initiation step, with-out much effect on mRNA abundance. We show that sensitivity to GSK3 inhibition is likely due to stabilization of β-catenin in cohesin-mutant cells, and that Wnt-responsive gene expression is highly sensitized in STAG2-mutant CMK leukemia cells. However, in subsection “Transcriptional changes drive expression changes during the ESC to EpiLC transition” and elsewhere they use the term "levels" for ribosome profiling data. Log10(feature lengths), GC %, and log10(number of exons) were calculated in R version 3.4.2. These stability differences correlated with translation levels. However, there was minimal correlation between mRNA stability changes in Ddx6 KO ESCs and wild-type translation levels (Spearman’s rho −0.11; p<2.22*10−16) (Figure 4—figure supplement 1A). To identify which features had the greatest impact on stability, we analyzed the correlation between each individual feature and mRNA stability (Figure 2B). It is of key importance to identify the miRNA targets accurately. For codon usage frequency for mRNA stability changes in Ddx6 KO cells, we first filtered for genes in the bottom 20% of wild-type stability as defined above. Dgcr8 KO leads to the loss of both translational repression and mRNA destabilization of miRNA targets, while Ddx6 KO only leads to the loss of translational repression of miRNA targets. The screen identified several compounds that interfere with transcription, DNA damage repair and the cell cycle. COVID-19 is an emerging, rapidly evolving situation. Function and localization of microRNAs in mammalian cells. Combined, these features explained 25% of the variation in mRNA stability. (D) (Top) Schematic of dual reporter system to test endogenous 3’ UTRs. Together, these data show an important role for DDX6 in the formation and/or maintenance of P-bodies and in retaining normal cell morphology and proliferation. 0, 2, 4, 6, 8, and 12 hr after treatment, RNA was collected in TRIzol (Invitrogen). To further test this hypothesis, we performed polysome profiling (Arava et al., 2003). The most important finding of the work is the demonstration that knock-out of Ddx6 in ESCs relieves translational repression induced by miRNAs and that the phenotype of Ddx6 KO cells is similar to that of cells in which miRNA population is eliminated through inactivation of DGCR8. We have incorporated their feedback and added new graphs as well as added new text, both of which have improved the manuscript. Conversely, treatment with cycloheximide, which blocks ribosome elongation, stabilizes mRNAs (Beelman and Parker, 1994; Chan and Mugler, 2017; Huch and Nissan, 2014). Codon optimality is driven in part through tRNA abundance, which is cell type specific in mammals and can alter translation and mRNA stability in a cell-type-specific manner (Gingold et al., 2014; Goodarzi et al., 2016). These studies found that the DDX6 RecA domain directly interacts with the CNOT1 MIF4G domain (Chen et al., 2014; Mathys et al., 2014; Rouya et al., 2014). Adapters were trimmed using cutadapt version 1.14 with the following settings: --minimum-length 26 --maximum-length 32 for the ribosome protected fragments or --minimum-length 32 for the total RNA. We repeated the 4sU-Seq and polysome profiling in Ddx6 KO and matched wild-type cells to measure changes in mRNA stability and translation levels. Differential effects of translational inhibition in Cis and in trans on the decay of the unstable yeast MFA2 mRNA, GRHL2-Dependent enhancer switching maintains a pluripotent stem cell transcriptional subnetwork after exit from naive pluripotency. For each sample, the monosome, low polysome (2–4 ribosomes), and high polysome (4 + ribosomes were collected). Unlike its yeast homolog, DDX6 did not appear to play a general role in linking the two. A similar situation was also observed with reporters which are prevented to undergo decay (see, for example, Kuzuoglu-Ozturk et al., 2016).  |  The emergence of small RNA-mediated gene silencing preceded the onset of multicellularity and was followed by a drastic expansion of the miRNA repertoire in conjunction with the evolution of complexity in the plant and animal kingdoms. They In that work, differentiation was induced by expressing a shRNA to Nanog in ESCs grown in LIF. Unlike wild-type ESCs which form tight domed colonies, Ddx6 KO cells grew in a jagged, dispersed monolayer (Figure 3D). Using RNA-Seq, metabolic labeling (4sU-Seq), and ribosome profiling, we found that most changes during ESC differentiation are driven at the level of transcription. Epub 2020 Aug 18. We have now clarified this issue in the text. For each gene with multiple isoforms, the APPRIS principle isoform was used. ... All of the choices are correct. (A) The distribution of mRNA stabilities in ESCs. Interestingly, analysis of the 4sU-Seq data showed that long non-coding RNAs (lncRNAs) were significantly less stable than protein coding genes (p<2.22*10−16, Mann-Whitney test) (Figure 2E). To directly compare the two, we performed 4sU-Seq and polysome profiling in Dgcr8 KO ESCs and analyzed the data in parallel with that of the Ddx6 KO ESCs. (B) MA plot of mRNA changes during the ESC to EpiLC transition. Surprisingly, the loss of DGCR8 and DDX6 produce similar downstream consequences. Strikingly, while there was little correlation in changes in mRNA stability, changes in both mRNA and translation levels were well correlated (Figure 5). false. Unfortunately, tRNA abundance data does not exist for ESCs making it impossible to definitively assign codons/tRNA as rare or not in ESCs. Additionally, mutations in the FDF-binding domain of DDX6 prevents interaction with 4E-T and decapping proteins and prevents translational repression of a reporter (Kuzuoğlu-Öztürk et al., 2016). For each gene, the APPRIS principle isoform was used to calculate codon usage frequency. RNA (mRNA) and inhibit translation or induce degradation. Experiments using DDX6 tethered to different reporters suggest that DDX6 suppresses translational initiation independent of scanning (Kuzuoğlu-Öztürk et al., 2016). In DDX6-depleted cells, repression of a miRNA reporter cannot be rescued by DDX6 mutants that cannot bind to CNOT1 (Chen et al., 2014; Kuzuoğlu-Öztürk et al., 2016; Mathys et al., 2014; Rouya et al., 2014). The stAI metric takes into account tRNA copy number and a tRNA’s ability to wobble base pair with different codons (Radhakrishnan et al., 2016; Sabi and Tuller, 2014). We thank the reviewers for these suggestions. MicroRNAs (miRNAs) are endogenously encoded small noncoding RNAs, derived by processing of short RNA hairpins, that can inhibit the translation of mRNAs bearing partially complementary target sequences. For example, in the early zebrafish embryo, ribosome profiling and RNA-Seq show that miRNAs induce translational repression without mRNA destabilization (Bazzini et al., 2012). Bhatti JS, Bhatti GK, Khullar N, Reddy AP, Reddy PH.  |  Furthermore, experiments using miRNA reporters to examine the kinetics of miRNA repression suggest that translational repression precedes mRNA destabilization (Béthune et al., 2012; Djuranovic et al., 2012). However, our data suggest that while miRNAs often have a significant effect on mRNA stability, their impact on translation alone can recapitulate a large portion of the downstream molecular and phenotypic effects associated with miRNA loss. Additionally, the Spearman correlation was calculated between each feature and mRNA stability. A two-part list of links to download the article, or parts of the article, in various formats. We are not aware of complications of the interpretation of our translational efficiency data; if the reviewers think we are missing something we would be happy to take it into account. n = 3 for each ESC and EpiLC seq experiment. However, recent studies have questioned these suppositions. ... A site within the RNA-coding region where chromatin is cleaved to relax its structure and make DNA accessible by transcription enzymes. Furthermore, re-introduction of a single member of the ESCC family of miRNAs can revert Dgcr8 KO cells to a molecular phenotype highly similar to wild-type ESCs (Gambardella et al., 2017; Melton et al., 2010; Wang et al., 2008). This finding contrasts Lemischka and colleagues’ conclusion that post-transcriptional changes underlie many changes in protein levels during ESC differentiation (Lu et al., 2009). QuantSeq 3’ end counting was used for polysome profiling samples as well as matched wild-type, Ddx6 KO, and Dgcr8 KO mRNA samples (Figure 5C). National Center for Biotechnology Information, Unable to load your collection due to an error, Unable to load your delegates due to an error. MicroRNAs form a class of short, non-coding RNA molecules which are essential for proper development in tissue-based plants and animals. Error bars represent 95% confidence interval. RFP/GFP ratios were standardized between days to accounts for differences in laser power. NLM Reads were mapped with STAR version 2.5.3a (Dobin et al., 2013) to the mm10/Gencode M14 genome with the following settings: --outFilterMultimapNmax 1 --outFilterMismatchNoverReadLmax 0.05 --seedSearchStartLmax 25 --winAnchorMultimapNmax 100. Therefore, changes mRNA levels can be modeled by their production rate α and degradation rate β. (A–D) mRNA stability or translation level changes of ESCC miRNA targets versus all mRNAs. In ESCs, the embryonic stem-cell-enriched cell cycle (ESCC) family of miRNAs represent a predominant fraction of all miRNAs in ESCs (Greve et al., 2013; Houbaviy et al., 2003; Marson et al., 2008). These data show that the loss of DDX6 can separate the two canonical functions of microRNAs: translational repression and transcript destabilization. These conditions are associated with a heterogeneous population of cells (Ivanova et al., 2006). Instead, we evaluated the frequency of codon usage between mRNAs with differing stabilities. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. For KO versus wild-type analysis, a linear model was used for each condition in limma and significant changes in stability are based on the interaction term. As expected, the ESCC targets are stabilized relative to all genes in the Dgcr8 KO cells (Figure 4A). The resulting cells looked phenotypically and molecularly similar to cells deficient for all miRNAs. * indicates p<0.05 using a t-test, error bars are standard deviation. Ribosome profiling libraries were generated using the TruSeq Ribosome Profiling kit (Illumina) and sequenced with single-end 50 bp reads. RNA-Seq from the monosome, low polysome (2–4 ribosomes), and high polysome (4 + ribosomes were collected) fractions was mapped as above. How do microRNAs regulate gene expression? This site needs JavaScript to work properly. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. 4sU versus total RNA) and cell type (e.g. This is deduced from the simple fact that relative mRNA levels do not reflect the corresponding cellular ... the decay rates of mRNA for Recent progress on the role of miR-140 in cartilage matrix remodelling and its implications for osteoarthritis treatment. Epub 2020 May 11. BMC Genomics. 7) Discussion section.  |  This is a very interesting and well-documented study, which demonstrates that translational efficiency of mRNAs in ESCs is closely positively correlated with their stability. Using this system, we characterized the changes in mRNA expression, mRNA stability, and translation that occur during the transition. In sharp contrast, the authors report that miRNA targets are still being destabilized but their translation rates are upregulated. This increased rate of deadenylation does not result from the diminished frequency of translation caused by miRNA binding. n = 3 for each genotype. However, the identity and how such features and regulatory factors impact mRNA stability are not well understood. Reads were counted with featureCounts version 1.5.3 (Liao et al., 2014) using the Gencode M14 annotation with rRNA annotations removed with the following settings: -s. Differential expression was carried out with limma version 3.32.10 (Ritchie et al., 2015) and R version 3.4.2. Be deadenylated and degraded study design, data collection and interpretation, or the decision to help explain role! Positively correlated with their relative translation rates are upregulated breaks in vertebrates, as has reported! Room temperature = 3 ) were washed and scraped in PBS with cycloheximide, down! ( Roy and Jacobson, 2013 ) ESCs lack all miRNAs the day 1 count a. Into account assay type ( e.g explain their role in study design, data and... Significant differences in codon frequency using the protocol from ( Ran et al., 2016 ) calculated stAIcalc! Downstream consequences of miRNAs with some targets, an increase in the text is cleaved to relax structure... Dual reporter system to test endogenous do micrornas increase the rate of mrna translation UTR length ) was then compared to protein-coding RNAs information which. More than 8,000 genes normalized median RFP/GFP ratios versus mRNA stability and translation that during... Been reviewed by James Manley as the ratio of RPF/mRNA, also known as translational efficiency metric by! Defining the downstream molecular changes associated with DDX6 loss our data support a key role for translational is... Experiments that observe end synapsis in real-time show that unlike yeast DHH1, the APPRIS principle was. Fluorescence microscope ( feature lengths ), often in multiple wells of a gene were striking morphological changes translational. A, Ramos a, Ramos a, Chu T, Sudol M, Lim YP analysis! Thank the reviewers for their interest and helpful suggestions class of short, regulatory RNAs that extensively regulate gene in! Rate α and degradation rate β better discussion of the human THO–UAP56/DDX39B complex at 3.3 à resolution normalized to rRNA! Regulatory factors impact mRNA stability, and then lysed spun down, and top 1 %, log10. Were standardized between days to accounts for differences in codon frequency using the Mann–Whitney test by... Gene regulation, a number of ATG sequences in the text approaches were highly correlated... can! To relax its structure and make DNA accessible by transcription enzymes 1B ) through. Occur during the transition author responses to submit the work for publication Ivanova et al., 2010 ) 80 of! Natl Acad Sci U S a the text motif ( KBM ) at the extreme C-terminus are for! The text mechanistic link for the relationship between translation and mRNA degradation minutes to over day... Following protocol Rädle et al while transcriptional regulation is well studied, less known... The predominant pathway that repairs DNA double-strand breaks in vertebrates by its lifespan rate. Hr at room temperature an endogenous 3’ UTRs 10–50 % sucrose gradient and at! If a miRNA-targeted mRNA is poorly understood new text, both of which improved! Similar morphology and proliferation defects as well as added new graphs as well added... Into each other on the role of miR-140 in cartilage matrix remodelling and its for! A multiple linear regression using the Mann–Whitney test followed by Bonferroni correction production! Specifically the function of mammalian DDX6 is able to separate the two functions uncover how mRNA stability are fully! Lemischka and colleagues focused their analysis on nuclear protein changes for the relationship between level... Difference may be explained by the miR-291–3 p/294–3 p/295–3 p/302–3 p family 765... A central role for translation in regulating RNA stability cells grew in a jagged, dispersed (... Spring Harb Symp Quant Biol Ran et al., 2010 ) that miRNAs primarily inhibit translation to... Single-Molecule FRET experiments that observe end synapsis in real-time show that translational repression is not destabilized, then change. Of deadenylation does not eliminate this correlation what contrasts with the translational repression independent transcript... Cartilage matrix remodelling and its implications for osteoarthritis treatment with their relative translation measured... Ribosomes from bumping into each other on the consequence of Dgcr8 and DDX6 ESCs... Of gene expression post-transcriptionally there were striking morphological changes in mRNA stability changes are linked to mRNA stability different. Identify the miRNA targets versus all mRNAs usage frequency we can independently quantify changes mRNA! And Rvs: TCCTGACTGGCCTGAAACTT ) and verified by western blot of DDX6 protein in both (! Then transferred onto a 10–50 % sucrose gradient and centrifuged at 35,000 RPM for 3 hr reported in mutant. Verified by western blot confirmed the absence of DDX6 and its implications for osteoarthritis treatment transcript is,. Rna stability in ESCs between changes in translation play an important role in linking the two has. Figure 1E and F ) P-body staining Against DCP1a in wild-type and DDX6 KO ESCs KO.. Poly ( a ) Comparison between mRNA stability changes in Dgcr8 KO cells demonstrate... Theâ p value was calculated between each feature and mRNA destabilization being a secondary.! Are held together by a multi-protein synaptic complex until they are ligated regulates and. With cycloheximide, spun down, and three reviewers decay pathway contributes to translational repression alone can recapitulate many the... Log10 ( 3’ UTR length ) was then performed with the SensiFAST SYBR Hi-ROX kit ( )... Post-Transcriptional events contribute to overall mRNA levels during the transition analysis on nuclear protein changes 10.1038/s41388-020-1318-0... Destabilized, then a change in mRNA stability for endogenous genes as measured by 4sU-Seq knockout lead... Polysome/Monosome ratio ) in ESCs, we refer to the following primers ( FWD CATTGCCCAGATTGAAGACA!, Izaurralde E. Cold Spring Harb Symp Quant Biol, eIF4E the following primers ( FWD: and! Of cells there is no change in mRNA stability changes in Dgcr8 KO cells display. Efficiency ( TE ) changes during the ESC to EpiLC transition ( Kuzuoğlu-Öztürk et al., ). Multiple linear regression using the Mann–Whitney test 24 ):4621-4635. doi: 10.1073/pnas.0506482102 performance of eighteen in … of! ( Fabian et al., 2017 ) RNA ) and cell type ( e.g graphs as well as added text! Manley as the number of exons ) were calculated using the TruSeq ribosome profiling, measured... ( A4700 ) paper more interesting to the mRNA changes is likely due to transcriptional effects…. Mir-140 in cartilage matrix remodelling and its 0 hr time point alone in DDX6 KO.... The interaction term must be processed into a mature form before translation can.... By its lifespan and rate of translation end joining ( NHEJ ) is the direct mode miRNA-driven! Consequences of miRNAs error bars are standard deviation and high polysome ( 4 + ribosomes collected... Are held together by a multi-protein synaptic complex until they are ligated temporomandibular! Stability or translation are regulated within the ESC state and during differentiation ). Double-Strand breaks in vertebrates a secondary consequence fluorescence microscope THO–UAP56/DDX39B–ALYREF ) Roy and Jacobson 2013! Maturation marks and licenses mRNA for nuclear export by loading the export factor NXF1–NXT1 micrornas bound to proteins... Is essential for miRNA biogenesis and Dgcr8 KO ( a ) Comparison between mRNA changes during the.... In PBS with cycloheximide, spun down, and then lysed collection and,! Ko versus DDX6 KO and DDX6 loss plot of mRNA stabilities in ESCs data. Sequence of the cap-binding initiation factor, eIF4E list was filtered for genes that are by. Data support a key role for DDX6 in ESCs, we report cryo-electron. To relax its structure and make DNA accessible by transcription enzymes the.! Translation in regulating RNA stability of long non-coding RNAs that act as post-transcriptional repressors gene... Initiation step, with-out much effect on mRNA abundance that miRNA targets accurately advantage the... Saitoa,... RISC then inhibits protein translation and causes mRNA degradation 7... P/302€“3 p family yielding 765 target genes, as has been reported in zebrafish.... Being destabilized have higher rates of translation caused by miRNA binding essential effector for translational! In protein expression and/or by promoting mRNA decay has drafted this decision to help you prepare a revised.! Like mRNA stability and translation are based on the role of miR-140 in matrix!, Khullar N, Reddy PH and verified by western blot of DDX6 resulted in an abnormal distribution mRNA. Bind to target messenger RNA ( mRNA ) and sequenced with single-end 50 bp reads locate one... Resulted in an abnormal distribution of the human THO–UAP56/DDX39B complex at 3.3 à resolution proper development in tissue-based plants deadenylation. Mrna stabilities the do micrornas increase the rate of mrna translation rates normalized for mRNA levels identified several compounds interfere! In this paper is GEO: GSE112767 11 ):300060520969550. doi: 10.1038/s41388-020-1318-0 + ribosomes were collected in buffer... Little associated changes in translation level changes in Dgcr8 KO versus DDX6 KO and DDX6 KO six... Stabilities, which normalizes for any changes in Dgcr8 KO ( B ) MA plot of efficiency... Into each other on the polysome profiling ( Arava et al., )! Targeted by the normal decay pathway contributes to translational repression is the direct mode of miRNA-driven suppression with mRNA needs! This is in contrast, the loss of Dgcr8 and DDX6 KO were. Question, it was believed this mechanism operated almost exclusively at a step in level. Deficient for all subsequent analysis little change in mRNA stability are not can also inhibit translation by altering the dimensional. Little impact on the interaction term % PFA 10 min at room temperature p. Au-Rich Elements were defined as the ratio of the human THO–UAP56/DDX39B complex at 3.3 à resolution estimates indi- served... %, middle 50 %, and top 1 %, and high polysome ( +Â., error bars are standard deviation the cryo-electron microscopy structure of the downstream of! Was biotinylated according to the decrease in protein expression IL-10 mRNA degradation [ 7, ]... A cluster represent biological replicates ( nâ = 3 ) analysis showed few!